Mr. Wright, is autism an epidemic or not? Why not give real examples of how to make a financial impact?

Left Brain Right Brain

Bob Wright co-founded Autism Speaks and was their representative to the congressional hearing held yesterday. As part of that hearing, he called autism an “epidemic”, stating:

More than seven years have passed since my wife, Suzanne, and I founded Autism Speaks. During that time, we have seen the prevalence of autism in America nearly double – from 1 in 166 children in 2005 to 1 in 88 today, including 1 of every 54 boys. The prevalence of autism has increased by 1,000 percent over the last 40 years.

Mr. Wright’s testimony also included the statement: “The annual cost of autism in the United States is now estimated at $137 billion – a
figure that exceeds the gross domestic product of 139 countries.”

I tried to work out how Mr. Wright arrived at that figure and couldn’t easily get there. Why, you might ask? It’s nice to cross check: do figures…

View original post 1,157 more words

Advertisements

California Police Ignored, Mishandled Sex Assaults Reported by Disabled

Left Brain Right Brain

This story from The Daily Beast: California Police Ignored, Mishandled Sex Assaults Reported by Disabled. Obviously potentially a trigger.

We’ve discussed sexual assaults in group homes in California in the past few years. Police made some of those cases priorities. The Daily Beast story discusses cases where there is a lack of even basic OK investigation:

Patients at California’s board-and-care centers for the developmentally disabled have accused caretakers of molestation and rape 36 times during the past four years, but police assigned to protect them did not complete even the simplest tasks associated with investigating the alleged crimes, records and interviews show.

View original post

Bob Wright snubs autistic adults, the same group who live in poverty

Left Brain Right Brain

The New York Post reported on Autism Speaks founder Bob Wright having a grumpy slap at adult autistic people who were protesting the fact that Autism Speaks still has no autistic representation on its Board.

Bob Wright had harsh words for protesters who tried to muck up the A-list benefit concert he put on at Carnegie Hall on behalf of autistic kids.

“The protesters are lucky,” said Wright. “They’re well off enough, healthy enough, to do it. I wish my grandson were able to join them.”

Wright runs Autism Speaks, which has raised over $200 million for research into a disorder that afflicts mainly children.

That didn’t stop a clutch of sign-carrying adult protesters from descending on Carnegie Hall Tuesday night, trying to disrupt a concert attended by Donald Trump, Howard Stern and Martha Stewart. Protesters complain that there’s not one autistic person on the board of the org, which…

View original post 456 more words

deepspacepirate:

deepspacepirate:

monkeysky:

intranet:

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

You got like six unique nucleotides so nice

OP is a virus from outer space

FUCK YOU OP